miRNA StarFire is a proprietary labeling system for generating radiolabeled oligo probes with 10-fold greater specific activity than traditional 5′-end labeling with polynucleotide kinase. It is based on 3′-end labeling with DNA polymerase. This labeling method is particularly useful for probes to identify small regulatory RNA and analyze the expression of microRNA genes. Includes: Exo-Klenow […]
- Integrated DNA Technologies
miRCat™ Small RNA Cloning Kit
miRCat small RNA cloning is based upon the preactivated, adenylated RNA linkering method that has been used successfully in many labs since its development in 2001. This method permits cloning from any RNA source in any species. Material sufficient for ten cloning experiments is provided in the miRCat kit. Also now included with the miRCat […]
microCache miRCat™-33 Conversion Oligos
miRCat-33 is a conversion of the miRCat kit for the purpose of performing 5′ ligation-independent small RNA cloning using the method of Pak and Fire. Contents: miRCat-33 3′ pre-activated, adenylated cloning linker Sequence- 5′-rAppTGGAATTCTCGGGTGCCAAGG/ddC/ -3′ miRCat-33 PCR Primer Sequence- 5′-CCTTGGCACCCGAGAATT -3′ Primer is included at no charge.
microCache 5′ M.R.S (Multiple Restriction Site) miRNA Cloning Linker
The 5′ M.R.S Linker sequence is designed for use with any of the 3′ miRNA cloning linkers. The sequence has been optimized for linking to the 5′ end of RNAs containing a 5′ phosphate group. The reaction is carried out with T4 RNA Ligase in the presence of 1 mM ATP. The sequence contains restriction […]
microCache 454 Adapter Primer Sets
454 Adaptor Primers are designed to convert small RNA libraries created by the miRCat Kit (Set I) or by the miRCat-33 Kit (Set II) into 454-compatible PCR libraries for deep sequencing. Set I: FOR: 5′- GCCTCCCTCGCGCCATCAGTGGAATTCTCGGGCACC -3′ REV: 5′- GCCTTGCCAGCCCGCTCAGGATTGATGGTGCCTACAG -3′ Set II: FOR: 5′- GCCTCCCTCGCGCCATCAGGATTGATGGTGCCTACAG -3′ REV: 5′- GCCTTGCCAGCCCGCTCAGCCTTGGCACCCGAGAATT -3′